View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1496_low_20 (Length: 216)
Name: NF1496_low_20
Description: NF1496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1496_low_20 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 4472752 - 4472537
Alignment:
| Q |
1 |
ccctatatataagtgtatctgtgcgcatgcgcatgcatgtgagttgtttttatcaaagtctttttcaaatttctgttttagatgggaagatagcattttg |
100 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4472752 |
ccctatatatatgtgtatctctgcgcatgcgcatgcatgtgagttgtttttatcaaagtctttttcaaatttctgttttagatgggaagatagcattttg |
4472653 |
T |
 |
| Q |
101 |
gtatgagctgttttctatgcacaacagatcctatcacgtacaattctaacatgatgattattaaattatatcggcccctaattttgtgatgttgggtgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4472652 |
gtatgagctgttttctatgcacaacagatcctatcacgtacaattctaacatgatgattattaaattatatcggcccctaattttgtgatgttgggtgaa |
4472553 |
T |
 |
| Q |
201 |
agcattaatgaacata |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
4472552 |
agcattaatgaacata |
4472537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University