View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1496_low_22 (Length: 205)
Name: NF1496_low_22
Description: NF1496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1496_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 91; Significance: 3e-44; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 88 - 190
Target Start/End: Complemental strand, 2024837 - 2024735
Alignment:
| Q |
88 |
ggacaaggacagcttagtgctttgacttgttttcaatttttgagcctgagtctctacactacttttgcttgccaaggaagttaacacaaaataatgaaaa |
187 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2024837 |
ggacaaggacagtttagtgctttgacttgttttccatttttgagcccgagtctctacactacttttgcttgccaaggaagttaacacaaaataatgaaaa |
2024738 |
T |
|
| Q |
188 |
aac |
190 |
Q |
| |
|
||| |
|
|
| T |
2024737 |
aac |
2024735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 88 - 190
Target Start/End: Original strand, 1958714 - 1958821
Alignment:
| Q |
88 |
ggacaaggacagcttagtgctttgacttgtttt--caatttttgagcctgagtctctacactactttt---gcttgccaaggaagttaacacaaaataat |
182 |
Q |
| |
|
||||||||||||||| || |||||||||||||| | |||||||||||||||||||||||||| | | |||||| |||||||||||||||||| ||| |
|
|
| T |
1958714 |
ggacaaggacagcttggtactttgacttgttttttccttttttgagcctgagtctctacactacatattaggcttgctaaggaagttaacacaaaagaat |
1958813 |
T |
|
| Q |
183 |
gaaaaaac |
190 |
Q |
| |
|
|||||||| |
|
|
| T |
1958814 |
gaaaaaac |
1958821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 2024915 - 2024886
Alignment:
| Q |
1 |
aatttgaatgaatgaatattgtttactttt |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2024915 |
aatttgaatgaatgaatattgtttactttt |
2024886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University