View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14970_high_3 (Length: 252)
Name: NF14970_high_3
Description: NF14970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14970_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 73 - 234
Target Start/End: Complemental strand, 251670 - 251508
Alignment:
| Q |
73 |
taaatgagaaattatgggtggttaccccttattcacatggaaacctaatatttccaccctttaataagagaataaaaagcagaaaatttatgaataatta |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
251670 |
taaatgagaaattatgggtggttaccccttattcacatgggaacctaatatttccaccctttaatatgagaataaaaagcagaaaatttatgaataatta |
251571 |
T |
|
| Q |
173 |
tagtctcacgtatacaaagtacctaagc-aaacatggaaatgaatgatttctaagaacacatt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
251570 |
tagtctcacgtatacaaagtacctaagcaaaacatggaaatgaatgatttctaagaacacatt |
251508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 251740 - 251689
Alignment:
| Q |
1 |
tggtttgtggcggggatgcctcatcttcatattttacacttcattgatttat |
52 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
251740 |
tggtttgtggcggtgatgcctcgtcttcatattttgcacttcattgatttat |
251689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University