View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14970_low_3 (Length: 252)
Name: NF14970_low_3
Description: NF14970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14970_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 245
Target Start/End: Complemental strand, 41445092 - 41444865
Alignment:
| Q |
18 |
aactttgaatctgattctgagctgttcaattacagtttccctcgcttaagagtattggagttatcttctctcagtttaactgaattgcccaaatcattcg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41445092 |
aactttgaatctgattctgagctgttcaattacagtttccctcgcttaagagtattggaattatcttctctcagtttaactgaattgcccaaatcattcg |
41444993 |
T |
|
| Q |
118 |
gagaaatatttccaagtttggtctatgtggatctatccaataataagttgagtggaagagtgccaaattggttaccagatatgtttttattacaatcttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41444992 |
gagaaatatttccaagtttggtctatgtggatctatccaataataagttgagtggaagagtgccaaattggttaccagatatgtttttattacaatcttc |
41444893 |
T |
|
| Q |
218 |
gaacctctctcgaaacatgttcatatca |
245 |
Q |
| |
|
||||||||||||||||||||||| |||| |
|
|
| T |
41444892 |
gaacctctctcgaaacatgttcacatca |
41444865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 18 - 157
Target Start/End: Complemental strand, 41432281 - 41432142
Alignment:
| Q |
18 |
aactttgaatctgattctgagctgttcaattacagtttccctcgcttaagagtattggagttatcttctctcagtttaactgaattgcccaaatcattcg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41432281 |
aactttgaatctgattctgagctgttcaattacagtttccctagcttaagagtattggagttatcttctctcagtttaactgaattgcccaaatcatttg |
41432182 |
T |
|
| Q |
118 |
gagaaatatttccaagtttggtctatgtggatctatccaa |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41432181 |
gagaaatatttccaagtttggtctatgtggatctatccaa |
41432142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University