View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14971_low_10 (Length: 240)

Name: NF14971_low_10
Description: NF14971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14971_low_10
NF14971_low_10
[»] chr5 (1 HSPs)
chr5 (14-223)||(6682822-6683031)


Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 14 - 223
Target Start/End: Complemental strand, 6683031 - 6682822
Alignment:
14 caaaggggataatgtatacataaaatttaatgtaatattatggaagatcctaaaacgtgtcgatgctgaaaaattggaatccaatatctaggaatggaat 113  Q
    |||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
6683031 caaaagggataatgtatacataaaatttaatgtaatattatggaaggtcctaaaacgtgtcgatgctgaaaaattggaatccaatatctaggaatggaat 6682932  T
114 cccaagtggtgtattatggtgctgtttagtgcgtttcgttgatggaaaataattcaagaaattcctgcaagccacgattaacatagctggtagcggacgg 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6682931 cccaagtggtgtattatggtgctgtttagtgcgtttcgttgatggaaaataattcaagaaattcctgcaagccacgattaacatagctggtagcggacgg 6682832  T
214 acaaggatga 223  Q
    ||||||||||    
6682831 acaaggatga 6682822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University