View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14971_low_12 (Length: 228)
Name: NF14971_low_12
Description: NF14971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14971_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 8e-88; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 6 - 212
Target Start/End: Original strand, 29917425 - 29917630
Alignment:
| Q |
6 |
agtttggtacgtataaacaactttctcaccgcatttgcagaagaattgatttgcgttgatagttgcatgtgttggggnnnnnnnnnnccaacttcttcaa |
105 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29917425 |
agtttggtatgtataaacaactttctcaccgcatttgcagaagaattgatttgcgttgatagttgcatgtgttggggttttttttt-ccaacttcttcaa |
29917523 |
T |
|
| Q |
106 |
cttcaccatactctgatggacgcccctccaattaagaagcaacgacgacgccgacccagtcgatccaatgcaacatatccgactttgttcctcccagacg |
205 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29917524 |
cttcactatactctgatggacgcccctccaattaagaagcaacgacgacgccgacccagtcgatccaatgcaacatatccgactttgttcctcccagacg |
29917623 |
T |
|
| Q |
206 |
aactcat |
212 |
Q |
| |
|
||||||| |
|
|
| T |
29917624 |
aactcat |
29917630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 186 - 228
Target Start/End: Original strand, 24001312 - 24001354
Alignment:
| Q |
186 |
gactttgttcctcccagacgaactcatcgtagaaatcctatct |
228 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
24001312 |
gactttgttcctcccagacgaactcatagcagaaatcctatct |
24001354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 228
Target Start/End: Original strand, 24009496 - 24009538
Alignment:
| Q |
186 |
gactttgttcctcccagacgaactcatcgtagaaatcctatct |
228 |
Q |
| |
|
|||||||||||||||||| |||||||| | ||||||||||||| |
|
|
| T |
24009496 |
gactttgttcctcccagatgaactcatagcagaaatcctatct |
24009538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University