View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14971_low_14 (Length: 214)
Name: NF14971_low_14
Description: NF14971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14971_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 36 - 195
Target Start/End: Complemental strand, 2787551 - 2787392
Alignment:
| Q |
36 |
gaacccggttggagttggaatcagatgtggagattgagtttgactctgtaccgataacaccgttgattttcgggttgagggacttcatccaacccaacat |
135 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2787551 |
gaactcggttcgagttggaatcagatgtggagattgagtttgactctgtaccgataacaccgttgattttcgggttgagggacttcatccaacccaacat |
2787452 |
T |
|
| Q |
136 |
gtggtcaaaagaacggttctcttgaaccaaaatgaccaccgttttgatggggtagctatg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2787451 |
gtggtcaaaagaacggttctcttgaaccaaaatgaccactgttttgatggggtagctatg |
2787392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University