View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14971_low_5 (Length: 295)
Name: NF14971_low_5
Description: NF14971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14971_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 25 - 151
Target Start/End: Complemental strand, 22828937 - 22828811
Alignment:
| Q |
25 |
cattgcatgtttgattagagtggtcattaagggttaatgggtatttggaagcaagaagaggaagattaagcaatgactgaaccatgggtattggatttgt |
124 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||| ||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22828937 |
cattgcatgtttgattagagtgatgattaagggttaatgggtacttgaaatcaagaagaggaagattaagcaatgactgaaccatgggtattggatttgt |
22828838 |
T |
|
| Q |
125 |
ggatgctgaaagctgttacagccttgg |
151 |
Q |
| |
|
||| ||||||||||||||||||||| |
|
|
| T |
22828837 |
caatggtgaaagctgttacagccttgg |
22828811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 160 - 255
Target Start/End: Complemental strand, 22828776 - 22828681
Alignment:
| Q |
160 |
aagcacagagaatcataaagctcatcagtttatgtgttcaaaaaattaggtgagttcatattcaaatttgatttgggatttacggttataatctat |
255 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
22828776 |
aagcacggagaatcataaagctcatcagtttatgtgttcaacaaattaggtgagttcatattcaaatttgatttgggatttacgattataagctat |
22828681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University