View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14971_low_7 (Length: 285)
Name: NF14971_low_7
Description: NF14971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14971_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 23 - 266
Target Start/End: Complemental strand, 36708025 - 36707782
Alignment:
| Q |
23 |
aaacataaaaatttagttttgaaaaacatttctctagaacaatatttaggtcggggcaacaaatgggagaatgtgaagagctccctccttttacatcatg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36708025 |
aaacataaaaatttagttttgaaaaacatttctctagaacaatatttaggtcggggcaacaaatgggagaatgtgaagagctccctccttttacatcatg |
36707926 |
T |
 |
| Q |
123 |
atttttccacctcaattactaatcatatccaatgagtattgatgttcaatagaaactcaaaacacaatgaaacccttgttgttaccacttaccaccacca |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36707925 |
atttttccacctcaattactaatcatatccaatgagtattgatgttcaatagaaactcaaaacacaatgaaacccttgttgttaccacttaccaccacca |
36707826 |
T |
 |
| Q |
223 |
tggttaaaaaatgacagcaatatttatgacgtaaggatgatagt |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36707825 |
tggttaaaaaatgacagcaatatttatgacgtaaggatgatagt |
36707782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University