View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14971_low_9 (Length: 243)
Name: NF14971_low_9
Description: NF14971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14971_low_9 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 17 - 243
Target Start/End: Complemental strand, 40569907 - 40569681
Alignment:
| Q |
17 |
atctaactggcgtcataataaattggaactcactgattaacacaaatttcacgtttgtttcaaaatcttaacgagttttccatttccaaaccctatattg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
40569907 |
atctaactggcgtcataataaattggaactcactgattaacacaaatttcacgtttgtttcaaaatcttaacgatttttccatttccaatccctatattg |
40569808 |
T |
|
| Q |
117 |
agttctagtagtgtaaattatttttatttaaaggaagaagtactgtgaaatactttgcatcttttcttgttgttcatattcatatttacatcacataaat |
216 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40569807 |
agttctagtagtgtaaatcatttttatttaaaggaagaagtactgtgaaatactttgcatcttttcttgttgttcatattcatatttacatcacataaat |
40569708 |
T |
|
| Q |
217 |
ccttatgaagatttagtaccatataac |
243 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
40569707 |
ccttatgaagatttagtaccatataac |
40569681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University