View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14974_low_5 (Length: 293)
Name: NF14974_low_5
Description: NF14974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14974_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 262; Significance: 1e-146; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 7 - 280
Target Start/End: Original strand, 8744423 - 8744696
Alignment:
| Q |
7 |
tagataattctacaaacaatgtaacatttacggcacagttgatttcatctttggtaacgctgctgcagtgttccaaaattgtaacatatttccaagaaac |
106 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8744423 |
tagacaattctacaaacaatgtaacatttacggtacagttgatttcatctttggtaacgctgctgcagtgttccaaaattgtaacatatttccaagaaac |
8744522 |
T |
|
| Q |
107 |
cctccaaacaaagttaacacaatcactgcacaaggtagaacagatcctaaccaaaacactggcatttctattcacaattctagggttaccgctgcttcgg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8744523 |
cctccaaacaaagttaacacaatcactgcacaaggtagaacagatcctaaccaaaacactggcatttctattcacaattctagggtcaccgctgcttcgg |
8744622 |
T |
|
| Q |
207 |
atttgaaaccggtccaaaattctgttaagacttatcttggaagaccatggaagcaatattctagggcagttttt |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8744623 |
atttgaaaccggtccaaaattctgttaagacttatcttggaagaccatggaagcaatattctagggcagttttt |
8744696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 24 - 108
Target Start/End: Original strand, 8767049 - 8767133
Alignment:
| Q |
24 |
aatgtaacatttacggcacagttgatttcatctttggtaacgctgctgcagtgttccaaaattgtaacatatttccaagaaaccc |
108 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||| || | ||| || |||||||||||||| || |||||||||| |
|
|
| T |
8767049 |
aatgtaacatctatggcacagttgatttcatctttggtaacgccgcggtagttttgcaaaattgtaacattttcgcaagaaaccc |
8767133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 126 - 160
Target Start/End: Complemental strand, 44463820 - 44463786
Alignment:
| Q |
126 |
caatcactgcacaaggtagaacagatcctaaccaa |
160 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
44463820 |
caatcactgcacaaggaagaacagatcctaaccaa |
44463786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 41 - 94
Target Start/End: Complemental strand, 8380780 - 8380727
Alignment:
| Q |
41 |
acagttgatttcatctttggtaacgctgctgcagtgttccaaaattgtaacata |
94 |
Q |
| |
|
||||||||||||||||||||||| | |||| ||||||||||||||| ||||| |
|
|
| T |
8380780 |
acagttgatttcatctttggtaattcagctgttgtgttccaaaattgtgacata |
8380727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University