View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14974_low_7 (Length: 237)
Name: NF14974_low_7
Description: NF14974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14974_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 35281671 - 35281620
Alignment:
| Q |
76 |
ttgctaccataatttgtttgtgaagttattagataacgtactctgaatagtg |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
35281671 |
ttgctaccataatttgtttgtgaagttattagataaggtactctgagtagtg |
35281620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 35276701 - 35276644
Alignment:
| Q |
1 |
tataagacttgtggctttttcacacacacgtctcttttcaca--cagagatgattgag |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
35276701 |
tataagacttgtggctttttcacacacacgtcttttttcacacgcagagatgattgag |
35276644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University