View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14974_low_9 (Length: 213)
Name: NF14974_low_9
Description: NF14974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14974_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 41 - 199
Target Start/End: Complemental strand, 36053288 - 36053130
Alignment:
| Q |
41 |
tataaaaccacctattatttttagtgttttcattgtatatatcgtgtctaccttaatttcttttataacacttaacagcatgtctattagcaggaatgtt |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36053288 |
tataaaaccacctattatttttagtgttttcattgtatatatcgtgtctaccttaatttcttttataacacttaacagcatgtctattagcaggaatgtt |
36053189 |
T |
 |
| Q |
141 |
atgaagccagcacgattagaattggtatttttaaaaacaatactttttctactccctat |
199 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36053188 |
atgaagccggcacgattagaattggtatttttaaaaacaatactttttctactccctat |
36053130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University