View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14974_low_9 (Length: 213)

Name: NF14974_low_9
Description: NF14974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14974_low_9
NF14974_low_9
[»] chr2 (1 HSPs)
chr2 (41-199)||(36053130-36053288)


Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 41 - 199
Target Start/End: Complemental strand, 36053288 - 36053130
Alignment:
41 tataaaaccacctattatttttagtgttttcattgtatatatcgtgtctaccttaatttcttttataacacttaacagcatgtctattagcaggaatgtt 140  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36053288 tataaaaccacctattatttttagtgttttcattgtatatatcgtgtctaccttaatttcttttataacacttaacagcatgtctattagcaggaatgtt 36053189  T
141 atgaagccagcacgattagaattggtatttttaaaaacaatactttttctactccctat 199  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
36053188 atgaagccggcacgattagaattggtatttttaaaaacaatactttttctactccctat 36053130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University