View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14975_high_14 (Length: 367)
Name: NF14975_high_14
Description: NF14975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14975_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 5e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 13 - 159
Target Start/End: Complemental strand, 13992572 - 13992426
Alignment:
| Q |
13 |
catcaattttggatgaccacttttacttatattttgaagtttcgattatatgtagaaaatgcagctggtgcggttgaaatttggggttagcaaagggttg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13992572 |
catcaattttggatgaccacttttacttatattttgaagtttcgattatatgtagaaaatgcagctggtgcggttgaaatttggggttagcaaagagttg |
13992473 |
T |
 |
| Q |
113 |
tggtgaacctcaaagttctttatattataatgtagctgcaattaatg |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13992472 |
tggtgaacctcaaagttctttatattataatgtagctgcaattaatg |
13992426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 238 - 273
Target Start/End: Complemental strand, 13992345 - 13992310
Alignment:
| Q |
238 |
ttgttgcgaagtactataacttaaaaaatagagagt |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
13992345 |
ttgttgcgaagtactataacttaaaaaatagagagt |
13992310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University