View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14975_high_18 (Length: 338)
Name: NF14975_high_18
Description: NF14975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14975_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 327
Target Start/End: Complemental strand, 21871203 - 21870884
Alignment:
| Q |
1 |
aaagttttggtgaattatttcagataatcatttggtgggctggcctaatgaggggagcagtctccattgctttggctttcaaacaggtatgtccatgaaa |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21871203 |
aaagctttggtgaattatttcagataatcatttggtgggctggcctaatgaggggagccgtctccattgctttggctttcaaacaggtatgcgcatgaaa |
21871104 |
T |
 |
| Q |
101 |
ttttcatttctagacattgtaattagagtgaactttataaaataaatgtgcattcatgtatcagggttttctccaacgtttatgtaaaccatgaataata |
200 |
Q |
| |
|
|||| ||| ||||||||||||| || ||||| |||||||||| ||| ||| ||||| | | |||||| || || ||||| |||||| ||||| |
|
|
| T |
21871103 |
ttttacttt-tagacattgtaatgagggtgaaatttataaaattaatatgcgttcatcga-----gatttctcgtacattcatgtag-ccatgagtaata |
21871011 |
T |
 |
| Q |
201 |
ttggtgtagcataaggaggaggtaccattgaattctcatctttttgtttatgcagttcacatactcaggtgttacttctgatccggttaatgcgacaatg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21871010 |
ttggtgtagcataaggaggaggtaccattgaattctcatctttttgtttatgcagttcacatactcaggggttacttctgatccggttaatgcgacaatg |
21870911 |
T |
 |
| Q |
301 |
attaccatcaccattattgttgttctt |
327 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
21870910 |
attaccatcaccattattgttgttctt |
21870884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University