View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14975_high_23 (Length: 303)
Name: NF14975_high_23
Description: NF14975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14975_high_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 16 - 297
Target Start/End: Complemental strand, 1769885 - 1769604
Alignment:
| Q |
16 |
atgatgaatcaggtctattagccttcaaatccggcatcaaatctgacccgacatccatgctcaagtcatggataccgggtacaaattgttgcacatgggt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1769885 |
atgatgaatcaggtctattagccttcaaatccggcatcaaatctgacccgacatccatgctcaagtcatggataccgggtacaaattgttgcacatgggt |
1769786 |
T |
|
| Q |
116 |
aggtgtagggtgtctggtcgacaaacgggtgacaagtttatctttaaccggtgacactgaaaatcctaaaagcttcttgtcaggtacaatctcaccatca |
215 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1769785 |
aggtgtagggtgtctggacaacaaacgggtgacaagtttatctttaaccggtgacactgaaaatcctaaaagcttcttgtcaggtacaatctcaccatca |
1769686 |
T |
|
| Q |
216 |
ctctcaaaactcaaattccttgatggaatctacttgataaacctcctcaaaatttctggtccatttcctgattttcttttca |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1769685 |
ctctcaaaactcaaattccttgatggaatctacttgataaacctcctcaaaatttctggtccatttcctgattttcttttca |
1769604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University