View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14975_low_16 (Length: 354)
Name: NF14975_low_16
Description: NF14975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14975_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 18 - 339
Target Start/End: Complemental strand, 14066003 - 14065685
Alignment:
| Q |
18 |
ctgataagtagcaatgataagtgattagcaacctgttagttagttatctagcagtatcagttagttatgaatttcccgcatttctagcttttcagttatg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14066003 |
ctgataagtagcaatgataagtgattagcaacctgttagttagttatctagcagttttagttagttatgaatttcccgcatttctagcttttcagttatg |
14065904 |
T |
|
| Q |
118 |
acagttagtagctgatttctcatgtattaataccgcaaaacctctccttcgttcattaatgagcatcagattgctcgttcatatcacttctttgctccga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14065903 |
acagttagtagctgatttctcatgtattaataccgcaaaacctctccttcgttcattaatgagcatcagattgctcattcatatcacttctttgctccga |
14065804 |
T |
|
| Q |
218 |
ggtttattttgttaatctggtatcattggtattttgagagcttttctttgctgcactctcatcatcatgcctcgaaattcttaactttattccaccatac |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14065803 |
ggtttattttgttaatctggtatcattggtattttgagagcttttctttgctgcactctca---tcatgcctcgaaattcttaactttattccaccatac |
14065707 |
T |
|
| Q |
318 |
tcattaatgggaatgttgtttc |
339 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
14065706 |
tcattaatgggaatgttgtttc |
14065685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University