View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14975_low_28 (Length: 285)
Name: NF14975_low_28
Description: NF14975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14975_low_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 57 - 275
Target Start/End: Original strand, 26052524 - 26052737
Alignment:
| Q |
57 |
gtacgagagaccgaattgagcaacacaaaacagcgtttgatttgatgaatggcagcgacgcaatttggaaggcgagtgggaaggatagtgaaagaaagaa |
156 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
26052524 |
gtacgagagacggaattgagcaacacaaaacagcgtttg-----atgaatggcaacgacgcaattcggaaggcgagtgggaaggatagtgaaagaaagaa |
26052618 |
T |
|
| Q |
157 |
tagaaagaaggaaaagcagcgttatacgtgaaggattatggaacgatcctttcatggttgcttctactcgcgccattgcagaaagaatccctttggttga |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26052619 |
tagaaagaaggaaaagcagcgttatacgtgaaggattatggaacgatcctttcatggttgcttctactcgcgccattgcagaaagaatccctttggttga |
26052718 |
T |
|
| Q |
257 |
tctcatcgttcatctcact |
275 |
Q |
| |
|
||||||||| ||| ||||| |
|
|
| T |
26052719 |
tctcatcgtccatgtcact |
26052737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 59
Target Start/End: Original strand, 26052202 - 26052242
Alignment:
| Q |
19 |
ctctaatcccctcaaaactcccaaatagaacctaagtggta |
59 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
26052202 |
ctctaatcccctcaaaacttccaaatagaacttaagtggta |
26052242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University