View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14976_high_4 (Length: 456)
Name: NF14976_high_4
Description: NF14976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14976_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 17 - 281
Target Start/End: Complemental strand, 56485832 - 56485568
Alignment:
| Q |
17 |
tgaacatgaacacggccacgacaactcttctgctgctgctgttgccataaaggtacgtacatgggtacatgtgactgtctaggatcgatccatgatgatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56485832 |
tgaacatgaacacggccacgacaactcttctgctgctgctgttgccataaaggtacgtacatgggtacatgtgactgtctaggatcgatccatgatgatt |
56485733 |
T |
 |
| Q |
117 |
ttattaagtcactcactgcctttgttttttatttggatcaaggttgttgttgacccagggaaacctccacaacttacatggcagcgcaaattaaacaatc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56485732 |
ttattaagtcactcactgcctttgttttttatttggattaaggttgttgttgacccagggaaacctccacaacttacatggcagcgcaaattaaacaatc |
56485633 |
T |
 |
| Q |
217 |
atgcaaatgcaaatgttccatcagaattcaccttatctttcaaagagatgattcatcttgtacgt |
281 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56485632 |
atgcaaattcaaatgttccatcagaattcaccttatctttcaaagagatgattcatcttgtacgt |
56485568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 341 - 441
Target Start/End: Complemental strand, 56485508 - 56485408
Alignment:
| Q |
341 |
tatataggctcccattggttatcgtctatggcgccatgttcgtgaagaagctgccaaaggaagggtacttaatcttataccttcttttcatctctatata |
440 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56485508 |
tatataggctcccattggttatcgtctatggcgccatgttcgtgaagaagcttccaaaggaagggtacttaatcttataccttcttttcatctctatata |
56485409 |
T |
 |
| Q |
441 |
t |
441 |
Q |
| |
|
| |
|
|
| T |
56485408 |
t |
56485408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University