View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14976_low_14 (Length: 285)
Name: NF14976_low_14
Description: NF14976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14976_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 4e-47; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 19 - 122
Target Start/End: Complemental strand, 2851162 - 2851059
Alignment:
| Q |
19 |
tgaaaaagataatcgtaagagatttcgattttaattttccggttctgaaaattctacgttggaatggtgttgtttacaaaaattgtaaaagtcttgtgaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
2851162 |
tgaaaaagataatcgtaagagatttcgattttaattttccggttctgaaaattctacgttggaatggtgttctttacaaaaatcgtaaaagtcttgtgaa |
2851063 |
T |
|
| Q |
119 |
gttt |
122 |
Q |
| |
|
|||| |
|
|
| T |
2851062 |
gttt |
2851059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University