View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14976_low_18 (Length: 244)

Name: NF14976_low_18
Description: NF14976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14976_low_18
NF14976_low_18
[»] chr2 (1 HSPs)
chr2 (180-229)||(7336492-7336541)


Alignment Details
Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 180 - 229
Target Start/End: Complemental strand, 7336541 - 7336492
Alignment:
180 ttgttgatgaatatagttgctcagttggatgttgtcttggggaatgtagt 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
7336541 ttgttgatgaatatagttgctcagttggatgttgtcttggggaatgtagt 7336492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University