View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14976_low_20 (Length: 216)
Name: NF14976_low_20
Description: NF14976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14976_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 3 - 173
Target Start/End: Complemental strand, 32620672 - 32620503
Alignment:
| Q |
3 |
ttttaattttattaaggaaataaaataactatttctttgatcagtagcatatatctttctaaaacaggtgatgtagtcattgtaaatccatgttgtaagc |
102 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32620672 |
ttttaattttattaaggaaataaaa-aactatttctttgatcagtagcatatgtctttctaaaacaggtgatgtagtcattgtaagtccatgttgtaagc |
32620574 |
T |
|
| Q |
103 |
tatttcatgctatgtataggtacatttctcattccatcatctcttagtaatgaaatagaagaaaatgttaa |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32620573 |
tatttcatgctatgtataggtacatttctcattccatcatcacttagtaatgaaatagaagaaaatgttaa |
32620503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University