View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14977_high_24 (Length: 221)
Name: NF14977_high_24
Description: NF14977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14977_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 11 - 204
Target Start/End: Original strand, 1558032 - 1558225
Alignment:
| Q |
11 |
gataatactgagtgtgtgttcttgccagcaaaccattatttatccattgttatttgcgatgttccgataacagtttacatttgtcggcttatagccatat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1558032 |
gataatactgagtgtgtgttcttgccagcaaaccattatttatccattgttatttgcgatgttccgataacagtttacatttgtcggcttatagccatat |
1558131 |
T |
 |
| Q |
111 |
tctttttctatgctaaatnnnnnnnnctgtttttgttttgttgttgatgagataaagcaaatgtagtaacatgagtttttacagctgtcatgtg |
204 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1558132 |
tctttttctatgctaaataaaaaaaactgtttttgttttgttgttgatgagataaagcaaatgtagtaacatgagtttttacagctgtcatgtg |
1558225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 23 - 126
Target Start/End: Original strand, 23891386 - 23891488
Alignment:
| Q |
23 |
tgtgtgttcttgccagcaaaccattatttatccattgttatttgcgatgttccgataacagtttacatttgtcggcttatagccatattctttttctatg |
122 |
Q |
| |
|
||||| |||||||| | |||| |||||||||||||||||| |||||||||| ||||||||||| |||||||| ||||||||||||| || |||||||| | |
|
|
| T |
23891386 |
tgtgtcttcttgcctgaaaacaattatttatccattgttagttgcgatgtttcgataacagttcacatttgtaggcttatagccat-ttttttttctacg |
23891484 |
T |
 |
| Q |
123 |
ctaa |
126 |
Q |
| |
|
|||| |
|
|
| T |
23891485 |
ctaa |
23891488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University