View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14977_high_26 (Length: 211)
Name: NF14977_high_26
Description: NF14977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14977_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 13 - 194
Target Start/End: Original strand, 41787416 - 41787596
Alignment:
| Q |
13 |
aagaatatatgtagggaaacgattgtaccctttaagggtatgcatgcacccattatttgcaaacctaatgtgcaggcaactaccgttaactctgtcttca |
112 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41787416 |
aagaacatatgtagggaaacgattgtaccctttaaaggtatgcatgcacccatt-ttcgcaaacctaatgtgcaggcaactaccgttaactctgtcttca |
41787514 |
T |
 |
| Q |
113 |
tttttcatccttttttatgtgaaaatccaatggatttagcaatgtgaacaaaactatgattgcaattaacaattatccagaa |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41787515 |
tttttcatccttttttatgtgaaaatccaatggatttagcaatgtgaacaaaactatgattgcaattaacaattatccagaa |
41787596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University