View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14977_low_12 (Length: 348)
Name: NF14977_low_12
Description: NF14977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14977_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 13 - 334
Target Start/End: Original strand, 30619121 - 30619442
Alignment:
| Q |
13 |
aatatcagttagtgaactatcaatgaataaattcaagctcaataaactaaggttcatgaatcaaattagtaatagttcatgtggtatttgcaaatgtata |
112 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30619121 |
aatatcagttaatgaactatcaatgaataaattcatgctcaataaactaaggttcatgaatcaaattagtaatagttcatgtggtatttgcaaatgtata |
30619220 |
T |
 |
| Q |
113 |
gtaccttctcaatgacgcaacgtactcttgccttgtcatatgcttcatttcttccacttctttttcataatggctaatctaaaattcattcattgttgac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30619221 |
gtaccttctcaatgacgcaacgtactcttgccttgtcatatgcttcatttcttccacttctttttcataatggctaatctaaaattcattcattgttgac |
30619320 |
T |
 |
| Q |
213 |
caacacatagaaatatccaatatcaacaagttgttatcacattaaaatataaagttttgcattataagggaaagaaaattaaacagacacattccatcaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30619321 |
caacacatagaaatatccaatatcaacaagttgttatcacattaaaatataaagttttgcattataagggaaagaaaattaaacagacacattccatcaa |
30619420 |
T |
 |
| Q |
313 |
atgaggaaattaatttactttt |
334 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
30619421 |
atgaggaaattaatttactttt |
30619442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University