View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14977_low_24 (Length: 267)
Name: NF14977_low_24
Description: NF14977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14977_low_24 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 267
Target Start/End: Original strand, 10553995 - 10554244
Alignment:
| Q |
17 |
tgggggaaaaagtgaatgaataagggttagcttgagatttctatatataggagataagagaaagagatgattagggttctcttctttatggatctttgac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10553995 |
tgggggaaaaagtgaatgaataagggttagcttgagatttctatatataggagataaga------gatgattagggttctcttctttatggatctttgac |
10554088 |
T |
|
| Q |
117 |
tcgggggttactcccatgtcgctactattgatgtgctttaatgtctttataaatattctctatcgtgatgtgatccttgttagtctacaaggatgttggg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10554089 |
tcgggggttactcccatgtcgctactattgatgtgctttaatgtctttatatatattctctatcgtgatgtgatccttgttagtctacaaggatgttggg |
10554188 |
T |
|
| Q |
217 |
tgtagtctcttgccatggct-----gtatgaatgtggagctggttcatcttgtata |
267 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
10554189 |
tgtagtctcttgccatggctctagagtatgaatgtggagctggatcatcttgtata |
10554244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University