View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14977_low_26 (Length: 247)
Name: NF14977_low_26
Description: NF14977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14977_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 7 - 53
Target Start/End: Original strand, 46308964 - 46309010
Alignment:
| Q |
7 |
tgatgtgagtgaatatcggcaactctagagtcaagaagtatatataa |
53 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46308964 |
tgatgtgggtgaatatcggcaactctagagtcaagaagtatatataa |
46309010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 47 - 136
Target Start/End: Complemental strand, 46014901 - 46014809
Alignment:
| Q |
47 |
tatataaattttacaaaattggttacccggtcaaacctaattcgggttacaag----ctttggcccatgtgttttatttcatttaaataaataa |
136 |
Q |
| |
|
|||| |||||||||||||| |||||||| |||||||| |||||||| | |||| |||||||||||| |||||||||| |||||||||||| |
|
|
| T |
46014901 |
tatagaaattttacaaaatcggttacccagtcaaacccaattcgggatgcaagttttttttggcccatgt-ttttatttcacttaaataaataa |
46014809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University