View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14977_low_27 (Length: 223)
Name: NF14977_low_27
Description: NF14977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14977_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 6 - 205
Target Start/End: Complemental strand, 41705222 - 41705033
Alignment:
| Q |
6 |
aggaggagcacagacccagggccagcccattaatttaataggcccaacaaaccagtactgctaatcataatcattactgctaagtgtgagatactagtaa |
105 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705222 |
aggaggaggacagacccagggccagcccattaatttaataggcccaacaaaccagtactactaatcataatcattactgctaagtgtgagatactagtaa |
41705123 |
T |
 |
| Q |
106 |
tttacaacagtttacacacaatgtagttactgctaagtccacatttattactgtgtaatgagcaacaaccaatcttcaaaattcagtaaactgggaattg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41705122 |
tttacaacagtttacacacaatgtagttactgctaagtccacatttattac----------gcaagccccaatcttcaaaattcagtaaactgggaattg |
41705033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University