View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14978_low_6 (Length: 239)
Name: NF14978_low_6
Description: NF14978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14978_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 14 - 226
Target Start/End: Complemental strand, 32270738 - 32270526
Alignment:
| Q |
14 |
gtatatcaaacatcttactgtaattatgctgcaggaggtagccgtatatgagaggtcccttgtgagctgtatgattttgaaagagcaaatatgcaaagaa |
113 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32270738 |
gtatatcaaacatcttattgtaattatgctgcaggaggtagccgtatatgagaggtcccttgtgagctgtatgattttgaaagagcaaatatgcaaagaa |
32270639 |
T |
|
| Q |
114 |
acaaagataaagtgttatgagcccctttccactttttaaagttgtccctttgtgttgaaacttcttttttaatcattcaagatcaagtacttcttctttt |
213 |
Q |
| |
|
||||||||||||||||||||| | |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32270638 |
acaaagataaagtgttatgagactctttccacttcttaaagttgtccctttgtgttgaaacttcttttttaatcattcaagatcaagtacttcttctttt |
32270539 |
T |
|
| Q |
214 |
tcaatcctttgct |
226 |
Q |
| |
|
||||||||||||| |
|
|
| T |
32270538 |
tcaatcctttgct |
32270526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University