View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14979_high_12 (Length: 393)
Name: NF14979_high_12
Description: NF14979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14979_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 15 - 371
Target Start/End: Original strand, 44998404 - 44998760
Alignment:
| Q |
15 |
gagaagaaggcggtgggaagcggaggagggagtacttgggaggtagctgtggtggaggagaggagaaagaggcagcaaataaggaggagaaggatgaaga |
114 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44998404 |
gagaaggaggcggtgggaagcggaggagggagtacttgggaggtagctgtggtggaggagaggagaaagaggcagcaaataaggaggagaaggatgaaga |
44998503 |
T |
 |
| Q |
115 |
tgaagggaaatggtgatcatggtgagaatgaagaaggagacgaggaggaagaagataacatcagtggtggcggtgagagacaaagagaacatccattcat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44998504 |
tgaagggaaatggtgatcatggtgagaatgaagaaggagacgaggaggaagaagataacatcagtggtggcggtgagagacaaagagaacatccattcat |
44998603 |
T |
 |
| Q |
215 |
tgtgacagagcctggggaagttgcacgtggcaaaaagaacggtctagattatctttttcatctctatgaacaatgtcgtgagttcttgattcaggttcaa |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44998604 |
tgtgacagagcctggggaagttgcacgtggcaaaaagaacggtctagattatctttttcatctctatgaacaatgtcgtgagttcttgattcaggttcaa |
44998703 |
T |
 |
| Q |
315 |
gccattgctaaggaacgcggtgagaaatgccctaccaaggtatactataccatgccc |
371 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44998704 |
gcaattgctaaggaacgcggtgagaaatgccctaccaaggtatactataccatgccc |
44998760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University