View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14979_high_28 (Length: 226)
Name: NF14979_high_28
Description: NF14979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14979_high_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 16 - 143
Target Start/End: Original strand, 30885081 - 30885206
Alignment:
| Q |
16 |
atgaacacataaataatctgtttgcttttgtttgtgaagcagtcagttgaaactgggtatatatattataaaaataattgtttgtggtagagtaaaatag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30885081 |
atgaacacataaataatctgtttgcttttgtttgtgaagcagtcagttgaaactgggtgtata--ttataaaaataattgtttgtggtagagtaaaatag |
30885178 |
T |
|
| Q |
116 |
ggtgagttgtctctatcaaaataaacgg |
143 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
30885179 |
ggtgagttgtctctatcaaaataaacgg |
30885206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 142 - 208
Target Start/End: Original strand, 30885518 - 30885584
Alignment:
| Q |
142 |
gggctcaatacatgtgtgctcttttactgtcatggtgcagcatctattggctgctgctgatctctat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30885518 |
gggctcaatacatgtgtgctcttttactgtcatggtgcagcatctattggctgctgctgatctctat |
30885584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University