View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14979_high_33 (Length: 202)
Name: NF14979_high_33
Description: NF14979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14979_high_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 18 - 188
Target Start/End: Complemental strand, 49114763 - 49114593
Alignment:
| Q |
18 |
gttgtaatgcaacttgtgttttataggatggttacacaaaagaggaaggtggtccaggctctgtgagggtacttgttgctacaaaagcaaagcctaaccg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49114763 |
gttgtaatgcaacttgtgttttataggatggttacacaaaagaggaaggtggtccaggctctgtgagggtacttgttgctacaaaagcaaagcctaaccg |
49114664 |
T |
|
| Q |
118 |
agatgttgggagttcacttgacagggaatatttcataagatttttagatgtatgtttaataatagaattat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49114663 |
agatgttgggagttcacttgacagggaatatttcataagatttttagatgtatgtttaataatagaattat |
49114593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 39 - 173
Target Start/End: Complemental strand, 49102555 - 49102421
Alignment:
| Q |
39 |
tataggatggttacacaaaagaggaaggtggtccaggctctgtgagggtacttgttgctacaaaagcaaagcctaaccgagatgttgggagttcacttga |
138 |
Q |
| |
|
|||||||||||||||||||||||| | ||||| || ||| ||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||| |
|
|
| T |
49102555 |
tataggatggttacacaaaagaggtacgtggtgaagactcggtgagggtacttgttgctacaaaagcaaagcctaaccaagatgttggaagttcgcttga |
49102456 |
T |
|
| Q |
139 |
cagggaatatttcataagatttttagatgtatgtt |
173 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||| |
|
|
| T |
49102455 |
cagggaatatttcataaactttttaaatgtatgtt |
49102421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 80 - 172
Target Start/End: Original strand, 6957702 - 6957794
Alignment:
| Q |
80 |
gtgagggtacttgttgctacaaaagcaaagcctaaccgagatgttgggagttcacttgacagggaatatttcataagatttttagatgtatgt |
172 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||| | |||| |||||||| || ||||| |||| ||| || ||| |||||||| |
|
|
| T |
6957702 |
gtgaaggtacttgttgctacaaaagcaaagcctaacaaggatataaggagctcacttgatagagaatacttcaaaagcttcttaaatgtatgt |
6957794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University