View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14979_low_28 (Length: 236)
Name: NF14979_low_28
Description: NF14979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14979_low_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 2325718 - 2325937
Alignment:
| Q |
1 |
ctttaattaatggatcgaggtaatttaaccatataatttttctttcttcatgtttttcatctttactcttgcaatcaattatagttcagctttgttccat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| || ||||||||||| |
|
|
| T |
2325718 |
ctttaattaatggatcgaggtaatttaaccatataatttttttttcttcatgtttttcatctttagtcttgcaatcaattatagtgcaactttgttccat |
2325817 |
T |
|
| Q |
101 |
ttaacagatggtaatacatgtctcaccacctttcgcgcacacactatatatccatccatagttattatt-aatcatatcccctagttctcatcatccatc |
199 |
Q |
| |
|
|||| || ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2325818 |
ttaagagggggtaatacatgtctcaccacctttcgcgcacacac--tatatccatccatacttattattaaatcatatcccctagttctcatcatccatc |
2325915 |
T |
|
| Q |
200 |
ctttggtttatacacacactat |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2325916 |
ctttggtttatacacacactat |
2325937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University