View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14979_low_31 (Length: 226)
Name: NF14979_low_31
Description: NF14979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14979_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 49363689 - 49363468
Alignment:
| Q |
1 |
caagagcctcaatgaggcatatatccatcacatgttgaccggaaagcctctgcttactttgaggtaattcaattccacttgcttttcactaaagattcat |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49363689 |
caagagcctcaatgaggcatatattcatcacatgttgaccggaaagcctctgcttactttgaggtaattcaattccacttgcttttcactaaagattcat |
49363590 |
T |
 |
| Q |
101 |
ttgtggatgttttcgattttgtcgagcacggattgcagaaaatagcagttcatccaaattctgcaatgcaacaatgttgtagtgtcgttgccatttgaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49363589 |
ttgtggatgttttcgattttgtcgagcacggattgcagaaaatagcagttcatccaaattctgcaatgcaacaatgttgtagtgtcgttgccatttgaca |
49363490 |
T |
 |
| Q |
201 |
atattggtgtcaatgccgagtc |
222 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
49363489 |
atattggtgtcaatgccaagtc |
49363468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 131 - 171
Target Start/End: Complemental strand, 41387412 - 41387372
Alignment:
| Q |
131 |
gattgcagaaaatagcagttcatccaaattctgcaatgcaa |
171 |
Q |
| |
|
||||||||||||||||||||||| |||||||| | |||||| |
|
|
| T |
41387412 |
gattgcagaaaatagcagttcattcaaattcttctatgcaa |
41387372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University