View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14979_low_32 (Length: 224)
Name: NF14979_low_32
Description: NF14979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14979_low_32 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 13 - 134
Target Start/End: Complemental strand, 31396838 - 31396716
Alignment:
| Q |
13 |
aaaagttta-ctcttaatctattcgagcatttacattctgaagagcttaatcaaacaataccatatttgagaccaaccttactgatgtagtcataaccgg |
111 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |||| ||||||||||||| || ||| || |
|
|
| T |
31396838 |
aaaagtttatctcttaatctattcgagcatttacattctgaagagcttaatcaaacaattccaaatttgatgccaaacttactgatgtagccagaacagg |
31396739 |
T |
|
| Q |
112 |
tactagttggaaccaatttaatt |
134 |
Q |
| |
|
||||||||||||| | ||||||| |
|
|
| T |
31396738 |
tactagttggaactactttaatt |
31396716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 5 - 134
Target Start/End: Complemental strand, 31381730 - 31381597
Alignment:
| Q |
5 |
tcatccctaaaagtttactcttaatctattc---gagcatttacattctgaagagcttaatcaaacaataccatatttgagaccaaccttact-gatgta |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||||||| ||||||||||||| |||| |||||||| |||||||||| |||||| |
|
|
| T |
31381730 |
tcatccctaaaagttatctcttaatctattatttgagcatttacattctgaagaccttaatcaaacaacaccaaatttgagatcaaccttactagatgta |
31381631 |
T |
|
| Q |
101 |
gtcataaccggtactagttggaaccaatttaatt |
134 |
Q |
| |
|
|||||||| ||||||||||| ||| ||||||||| |
|
|
| T |
31381630 |
gtcataacaggtactagttgtaacaaatttaatt |
31381597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University