View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1497_high_21 (Length: 316)
Name: NF1497_high_21
Description: NF1497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1497_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 20 - 300
Target Start/End: Complemental strand, 33552409 - 33552129
Alignment:
| Q |
20 |
tctgaggtaaattattactccaatcaatttgtatgatcattctttcccccttttaggggttattctttttctttgacggattttatggggtattcttaag |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33552409 |
tctgaggtaaattattactccaatcaatttgtatgatcattctttcccccttttaagggttattctttttctttgacggattttatggggtattcttaag |
33552310 |
T |
 |
| Q |
120 |
tttgtaagttagtgtcaactattgggagatgactcggtccctagggtgtagnnnnnnnnnnnnnnnnnnnattaatatgaacttgtttcttactctaata |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33552309 |
tttgtaagttagtgtcaactattgggagatgactcggtccctagggtgtagtttattattattatttttaattaatatgaacttgtttcttactctaata |
33552210 |
T |
 |
| Q |
220 |
tactcatatctgttcttgatactctacaaagatttataactttgattcatgtacnnnnnnngttgaaaatgggaacaatag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33552209 |
tactcatatctgttcttgatactctacaaagatttataactttgattcatgtacaaaaaaagttgaaaatgggaacaatag |
33552129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University