View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1497_high_32 (Length: 236)
Name: NF1497_high_32
Description: NF1497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1497_high_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 39 - 207
Target Start/End: Complemental strand, 35363964 - 35363793
Alignment:
| Q |
39 |
cttttctgaaaggtttattcaaattaagttatttactgnnnnnnnn-attacattcctaatttttcctatcaataatat--ctctattaacaaaaattta |
135 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||||||||||||||| | |
|
|
| T |
35363964 |
cttttctgaaaaggttattcaaattaagttatttactgtttttttttattacattcctaattttttctatcaataatatatctctattaacaaaaattaa |
35363865 |
T |
 |
| Q |
136 |
acatcaaataatatcaaaatcgaatcaattttaaatgtaaaatagatagattggtgaaaaaattggtatata |
207 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35363864 |
acgtcaaataatatcaaaatcgaatcaattttatatgtaaaatagatagattggtgaaaaaattggtatata |
35363793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University