View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1497_low_12 (Length: 446)
Name: NF1497_low_12
Description: NF1497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1497_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 9e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 9e-74
Query Start/End: Original strand, 246 - 430
Target Start/End: Original strand, 40044223 - 40044407
Alignment:
| Q |
246 |
agtaaacacaaactttttgcaattcaattcctggataacaaacatggtataaatgctccacggcacttaattgccgatagatagaactggagatcggcag |
345 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| |||||||||||| |
|
|
| T |
40044223 |
agtaaacacaaactttttgcgattcaattcctggataacaaacatggtataaatgctccacggcacttaactgccgatggatagaatcggagatcggcag |
40044322 |
T |
|
| Q |
346 |
ttaactatcatcggttaactcccgcgactgttaactgtcgatgaggtcatttcaataatttattggtgttttcaattaaactata |
430 |
Q |
| |
|
||||||| || ||||||||| || || ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40044323 |
ttaactaccaccggttaacttccacggctgttaattgtcgatgaggtcatttcaataatttattggtgttttcaattaaactata |
40044407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 2e-16; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 215 - 302
Target Start/End: Original strand, 49121240 - 49121330
Alignment:
| Q |
215 |
gtgaataaaattcatttcaattgtttcttacagta---aacacaaactttttgcaattcaattcctggataacaaacatggtataaatgct |
302 |
Q |
| |
|
|||||||||| ||| ||||||||||| |||||||| ||||||||||||||| ||| |||||||||||||||||| |||||||| |||| |
|
|
| T |
49121240 |
gtgaataaaagtcacttcaattgtttattacagtactgaacacaaactttttgagattgaattcctggataacaaacctggtataagtgct |
49121330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 71 - 127
Target Start/End: Original strand, 13622353 - 13622409
Alignment:
| Q |
71 |
gaaaattgctcttgacacttaatagttcgctgaaaaacatcaataaattactaaaat |
127 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
13622353 |
gaaaattgttgttgacacttaatagttcgctgaaaaacacctgtaaattactaaaat |
13622409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 71 - 127
Target Start/End: Complemental strand, 25912377 - 25912321
Alignment:
| Q |
71 |
gaaaattgctcttgacacttaatagttcgctgaaaaacatcaataaattactaaaat |
127 |
Q |
| |
|
|||||||| | ||||||||| |||||| |||| |||||| ||||||||||||||||| |
|
|
| T |
25912377 |
gaaaattgatgttgacacttcatagtttgctggaaaacaccaataaattactaaaat |
25912321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University