View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1497_low_21 (Length: 353)
Name: NF1497_low_21
Description: NF1497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1497_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 21 - 164
Target Start/End: Original strand, 33887117 - 33887260
Alignment:
| Q |
21 |
tatcttgtgtcactcatttcaaaataaaagttaaaataatttatagcaggtggtagttttattatattcttacttctcagcaaatctcttccgctcttcc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33887117 |
tatcttgtgtcactcatttcaaaataaaagttaaaataatttatagcaggtggtagttttattatatacttacttctcagcaaatctcttccgctcttcc |
33887216 |
T |
 |
| Q |
121 |
ctctcaaaatttgcaaagaattcatcaatctcctcttccctgaa |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
33887217 |
ctctcaaaatttgcaaagaattcatcaatctccgcctccctgaa |
33887260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 270 - 353
Target Start/End: Original strand, 33887347 - 33887430
Alignment:
| Q |
270 |
tacctgaacgatttttaattgtggttgtttttgtctaccgtttcagaacatttagttttcaattgcaagatcattacagtaatt |
353 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||| |||| |||||||||| ||||||||||| ||||||||| |
|
|
| T |
33887347 |
tacctgaacgattttaaattgtggttcgttttgtctaccgtttcaaaacacttagttttcagctgcaagatcatcacagtaatt |
33887430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University