View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1497_low_25 (Length: 323)

Name: NF1497_low_25
Description: NF1497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1497_low_25
NF1497_low_25
[»] chr1 (1 HSPs)
chr1 (46-218)||(43879436-43879608)


Alignment Details
Target: chr1 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 46 - 218
Target Start/End: Complemental strand, 43879608 - 43879436
Alignment:
46 cccttttcttcttcgtcgaagatcggaacggagagtgtggtggtggaacaaacgcttatggtagtaaagaggaagaagattggaggagcaacgcttcacc 145  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43879608 cccttctcttcttcgtcgaagatcggaacggagagtgtggtggtggaacaaacgcttatggtagtaaagaggaagaagattggaggagcaacgcttcacc 43879509  T
146 ttcttcctcttgatttcatggctgctcctcagtcccaacatcgcactgtctttggtatatttatcttcctatc 218  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43879508 ttcttcctctcgatttcatggctgctcctcagtcccaacatcgcactgtctttggtatatttatcttcctatc 43879436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University