View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1497_low_29 (Length: 282)
Name: NF1497_low_29
Description: NF1497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1497_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 17 - 265
Target Start/End: Original strand, 49256187 - 49256435
Alignment:
| Q |
17 |
tatacaataccagaagcaactggctcagcagcaaggttttgattcacatcattcaaaacccattcaatttgtgcatacacatttttctgtacaaataaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49256187 |
tatacaataccagaagcaactggctcagcagcaaggttttgattcacatcattcaaaacccattcaatttgtgcatacacatttttctgtacaaataaaa |
49256286 |
T |
|
| Q |
117 |
agtgatgctatttctttgtttgtgtttggtttttcttttcgttgtgttattcagtgcaagagtttcaaatgcattaggagctggatgtccacacgcagca |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49256287 |
agtgatgctatttctttgtttgtgtttggtttttcttttcgttgtgtcattcagtgcaagagtttcaaatgcattaggagctggatgtccacacgcagca |
49256386 |
T |
|
| Q |
217 |
cgattgtctgtctatgctgctatggctatcgcagtttctgaggctatat |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49256387 |
cgattgtctgtctatgctgctatggctatcgcagtttctgaggctatat |
49256435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 175 - 263
Target Start/End: Original strand, 49269303 - 49269391
Alignment:
| Q |
175 |
agagtttcaaatgcattaggagctggatgtccacacgcagcacgattgtctgtctatgctgctatggctatcgcagtttctgaggctat |
263 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||| ||||||||||||| |||| ||||| | | ||||||||||||||||| |
|
|
| T |
49269303 |
agagtttcaaatgcattaggaggtggatgtccacaagcagcgcgattgtctgtctttgcttctatgaccgttgcagtttctgaggctat |
49269391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 10 - 65
Target Start/End: Original strand, 49269163 - 49269218
Alignment:
| Q |
10 |
aacaatatatacaataccagaagcaactggctcagcagcaaggttttgattcacat |
65 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49269163 |
aacaatctatacaataccagaagcaactggctcagcagcaaggttttgattcacat |
49269218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University