View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1497_low_32 (Length: 259)
Name: NF1497_low_32
Description: NF1497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1497_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 36 - 240
Target Start/End: Original strand, 33978176 - 33978404
Alignment:
| Q |
36 |
acatgtgacattctggtacaaattaaaatagacgagtcttgtgtgaaagtataatctatggaaactggaaagatggagtagttagagtcattggcaatgc |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33978176 |
acatgtgacattctggtacaaattaaaatagacgagtcttgtgtgaaagtataatctatggaaactggaaagatggagtagttagagttattggcaatgc |
33978275 |
T |
|
| Q |
136 |
agtactgtagcaggtacgacatggctagaa------atataaaatataagcatctttgccgttttt------------------atttgcgactgcatca |
211 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33978276 |
agtaccgtagcaggtacgacatggctagaactagaaatataaaatataagcatctttgccgttttttaatgcagtagtgtgtgaatttgcgactgcatca |
33978375 |
T |
|
| Q |
212 |
aatccagatccatgtatgatatacataca |
240 |
Q |
| |
|
|||||||||||||||||||||| |||||| |
|
|
| T |
33978376 |
aatccagatccatgtatgatatgcataca |
33978404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University