View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1497_low_36 (Length: 249)
Name: NF1497_low_36
Description: NF1497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1497_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 78 - 237
Target Start/End: Original strand, 33552513 - 33552672
Alignment:
| Q |
78 |
ctgtgtgtctcatgccaaccttgtgcaaataagtagagcttgaccttaacttgttattcaaagtcctcttagctgaaatggttaattcaatttagtagct |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33552513 |
ctgtgtgtctcatgccaaccttgtgcaaataagtagagcttgaccttaacttgttattcaaagtcctcttagctgaaatggttaattcaatttagtagct |
33552612 |
T |
|
| Q |
178 |
tgggaattcccaagggtatatctatctttgagtttaagtttttctttttgggacaatatt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
33552613 |
tgggaattcccaagggtatatctatctttgagtctaagtttttctttttggaacaatatt |
33552672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 33552435 - 33552489
Alignment:
| Q |
1 |
catggattggaccaaaatccacctcagatcatgttgtgtgtgtcatgctgccatt |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33552435 |
catggattggaccaaaatccacctcagatcatgttgtgtgtgtcatgctgccatt |
33552489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University