View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1497_low_41 (Length: 230)
Name: NF1497_low_41
Description: NF1497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1497_low_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 75 - 209
Target Start/End: Complemental strand, 31604904 - 31604766
Alignment:
| Q |
75 |
tttagggattaatccatggtttgtttgaaaaatgagtgcaataatgttgatcaataatagatgcatatatgaat----atatacattgtttgttgcagtt |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31604904 |
tttagggattaatccatggtttgtttgaaaaatgagtgcaataatgttgatcaataatagatgcatatatgaatatgaatatacattgtttgttgcagtt |
31604805 |
T |
 |
| Q |
171 |
tatggatgcagaaatatatggtagtgggttgatagctgt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31604804 |
tatggatgcagaaatatatggtagtgggttgatagctgt |
31604766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 85 - 207
Target Start/End: Complemental strand, 31594646 - 31594516
Alignment:
| Q |
85 |
aatccatggtttgtttgaaaaatgagtgcaataatgttgatcaataatagatgcatatatgaata--------tatacattgtttgttgcagtttatgga |
176 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| ||| |||||| |||||| |||||||| ||||||||||||| |||| |
|
|
| T |
31594646 |
aatcgatggtttgtttgaaaaatgagtgcaataatgttgatcaatagtagctgcatacttgaatatttatatgtatacattatttgttgcagtttctgga |
31594547 |
T |
 |
| Q |
177 |
tgcagaaatatatggtagtgggttgatagct |
207 |
Q |
| |
|
| ||||| |||||||||||||||||||||| |
|
|
| T |
31594546 |
tcaagaaacatatggtagtgggttgatagct |
31594516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 31605059 - 31604991
Alignment:
| Q |
1 |
tctaattttccattatgtatgtgattaatttgcatagagagaaaaaggaggaataaacgatgatttagt |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
31605059 |
tctaattttccattatgtatgtgattaatttgcatagagagaaaaatgaggaataaactatgatttagt |
31604991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University