View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1497_low_45 (Length: 223)
Name: NF1497_low_45
Description: NF1497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1497_low_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 36704365 - 36704154
Alignment:
| Q |
1 |
atcccatgatagcttttttcaactctcattgattttactaccacgatatatttattatattgtacttcaaataatgtattgtagcatataggagtagttt |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
36704365 |
atcccataatagcttttttcaactctcattgattttactaccaagatatatttattatattgtactacaaataatgtattgtagtatataggagtagttt |
36704266 |
T |
 |
| Q |
101 |
tttcatttagttgagattcattcgagtgnnnnnnnnctcaactgagtatgttagatttccatcaaaattaaaataaaaagaatatagactgtgttattct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36704265 |
tttcatttagttgagattcattcgagtgttttttttctcaactgagtatgttagatttccatcaaaattaaaataaaaagaatatagactgtgttattct |
36704166 |
T |
 |
| Q |
201 |
tctccatattta |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
36704165 |
tctccatattta |
36704154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 36711512 - 36711475
Alignment:
| Q |
1 |
atcccatgatagcttttttcaactctcattgattttac |
38 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36711512 |
atcccatgatagcttttttcaacgctcattgattttac |
36711475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 143 - 183
Target Start/End: Complemental strand, 36711398 - 36711358
Alignment:
| Q |
143 |
tgagtatgttagatttccatcaaaattaaaataaaaagaat |
183 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
36711398 |
tgagtatgttagatttccgtcaaaattaaaacaaaaagaat |
36711358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 30905800 - 30905837
Alignment:
| Q |
1 |
atcccatgatagcttttttcaactctcattgattttac |
38 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
30905800 |
atcccatgatagcttttttcaacgctcattaattttac |
30905837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University