View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1497_low_49 (Length: 207)
Name: NF1497_low_49
Description: NF1497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1497_low_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 2e-32; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 118 - 192
Target Start/End: Complemental strand, 22291239 - 22291165
Alignment:
| Q |
118 |
gaattaaaacaggtgattcaatcccagttgtataagattgctctggcatatgtaaggatgggattcatggatgtt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22291239 |
gaattaaaacaggtgattcaatcccagttgtataagattgctctggcatatgtaaggatgggatttatggatgtt |
22291165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 118 - 192
Target Start/End: Original strand, 24124235 - 24124309
Alignment:
| Q |
118 |
gaattaaaacaggtgattcaatcccagttgtataagattgctctggcatatgtaaggatgggattcatggatgtt |
192 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
24124235 |
gaataaaaataggtgattcaatcccagttgtataagattgctccgacatatgtaaggatgggattcatggatgtt |
24124309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 55; Significance: 8e-23; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 118 - 192
Target Start/End: Complemental strand, 15433352 - 15433278
Alignment:
| Q |
118 |
gaattaaaacaggtgattcaatcccagttgtataagattgctctggcatatgtaaggatgggattcatggatgtt |
192 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||| ||| | ||||||||||||||||||||||||||||| |
|
|
| T |
15433352 |
gaattaaaacaggtgattcaatccaaattgtataagattcctccgacatatgtaaggatgggattcatggatgtt |
15433278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 118 - 192
Target Start/End: Original strand, 40964851 - 40964925
Alignment:
| Q |
118 |
gaattaaaacaggtgattcaatcccagttgtataagattgctctggcatatgtaaggatgggattcatggatgtt |
192 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||| |
|
|
| T |
40964851 |
gaattaaaataggtgattcaatcccagttgtataagtatgctccagcatatgtaaggatatgattcatggatgtt |
40964925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University