View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14980_high_5 (Length: 219)
Name: NF14980_high_5
Description: NF14980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14980_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 38 - 205
Target Start/End: Complemental strand, 31773243 - 31773076
Alignment:
| Q |
38 |
acacgtgataatatttttcattgccaaaatcacattgtaaaattcagtttgaataatgaaatagaatttctttctatgttttgcagagcatctctttcct |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31773243 |
acacgtgataatatttttcattgccaaaatcacattgtaaaattcagtttgaataatgaaatagaatttctttctatgttttgcagagcatctctttcct |
31773144 |
T |
|
| Q |
138 |
taataattttcattgccaaaatcacttttcacataaaggttataatatttgactttcaacttcttcat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31773143 |
taataattttcattgccaaaatcacttttcacataaaggtaataatatttgactttcaacttcttcat |
31773076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University