View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14980_low_5 (Length: 265)
Name: NF14980_low_5
Description: NF14980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14980_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 24 - 181
Target Start/End: Original strand, 49572366 - 49572526
Alignment:
| Q |
24 |
aattaatgaagttttgatatttgaagaagatgtcatagtccatgccaacaacgcccgaaatttactcctactaccattgaaagaggaaatggatgagacg |
123 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49572366 |
aattaatgaagttttgatatttgaaga---tgtcatagtccatgccaacaacgcccgaaatttactcctactaccattgaaagaggaaatggatgagacg |
49572462 |
T |
 |
| Q |
124 |
catatat----gact--gattaaaatcttcatcaagcaaggcgtaacagaaattgtcatattct |
181 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49572463 |
catatatatatgactatgattaaaatcttcatcaagcaaggcgtaacaaaaattgtcatattct |
49572526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 167 - 246
Target Start/End: Original strand, 49578527 - 49578609
Alignment:
| Q |
167 |
aaattgtcatattctaccaaactaatta-tgactcacaataatagatatccggtc--aaaaatctcacaacaataatacatct |
246 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
49578527 |
aaattgtcatattctaccaaactaattaatgactcacaataatagatatccggtcaaaaaaatctcacaacaataatacatct |
49578609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University