View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14981_high_21 (Length: 289)
Name: NF14981_high_21
Description: NF14981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14981_high_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 265; Significance: 1e-148; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 33791172 - 33790904
Alignment:
| Q |
1 |
agttgatactaatccatcacgtcttcctgtaggaacattgtaacttggtccacctgctaagacaactgaatctcttgttgctaatgatattatgtctgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33791172 |
agttgatactaatccatcacgtcttcctgtaggaacattgtaacttggtccacctgctaagacaacagaatctcttgttgctaatgatattatgtctgca |
33791073 |
T |
|
| Q |
101 |
catgaaactgttgatggacatgcattttctaggattcttttgatttcatctatgaggttatatcctcttacagtaaggtttgctcttgctgctttctctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33791072 |
catgaaactgttgatggacatgcattttctaggattcttttgatttcatctatgaggttatatcctcttacagtaaggtttgctcttgctgctttctctg |
33790973 |
T |
|
| Q |
201 |
attcattgcccttctttgagtctattaatatggatgcgtcacacccctgaaattaaatcaaccaaattg |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33790972 |
attcattgcccttctttgagtctattaatatggatgcgtcacacccctgaaattaaatcaaccaaattg |
33790904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 10 - 124
Target Start/End: Original strand, 33764098 - 33764212
Alignment:
| Q |
10 |
taatccatcacgtcttcctgtaggaacattgtaacttggtccacctgctaagacaactgaatctcttgttgctaatgatattatgtctgcacatgaaact |
109 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||| ||||||| || | |||| | || | ||||||||| || | || || ||||||||||||||||| |
|
|
| T |
33764098 |
taatccgtcacgtcttcctgtaggaatattgtattttggtcctccagataaggccacagcatctcttgtagcaagtgctacgatgtctgcacatgaaacc |
33764197 |
T |
|
| Q |
110 |
gttgatggacatgca |
124 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33764198 |
gttgatggacatgca |
33764212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University