View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14981_high_9 (Length: 389)
Name: NF14981_high_9
Description: NF14981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14981_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 20 - 378
Target Start/End: Original strand, 2132395 - 2132754
Alignment:
| Q |
20 |
cttataagatatctccaagttacactatctctctacttgaaaaccatgcacaatgacttaaatatgagcttcaaaattggtataggtctcttgcactatg |
119 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2132395 |
cttataagatatatccaagttacactatctctctacttgaaaaccatgcacaatgacttaaatatgagcttcaaaatttgtataggtctcttgcactatg |
2132494 |
T |
 |
| Q |
120 |
caccacc-tcattgtggtcaaagagccgttgccaaaggcgtctcgcatttgaggcattgagggtaggcttgaaaattgctttagaaatatgtcctactag |
218 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2132495 |
caccaccctcattgtggtcaaagagccattgccaaaggcgtctcgcatttaaggcattgagggtaggcttgaaaattgctttagaaatatgtcctactag |
2132594 |
T |
 |
| Q |
219 |
gtgcctcataattcgaacatgggacatctaatgtccaatttgtgaacatgcacaaatgaaatttgaaatcactcacaacaattatccaccttgcccttaa |
318 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2132595 |
gtgccttgtaattcgaacatgggacatccaatgtccaacttgtgaacatgcacaaatgaaatttgaaatcactcacaacaattatctaccttgcccttaa |
2132694 |
T |
 |
| Q |
319 |
attgatggtgatgccgatttaaacactaacaatcttgctgctttctccatcctgagtatt |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2132695 |
attgatggtgatgccgatttaaacactaacaatcttgctgctttctccatcctgagtatt |
2132754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 333
Target Start/End: Original strand, 46776167 - 46776205
Alignment:
| Q |
295 |
aacaattatccaccttgcccttaaattgatggtgatgcc |
333 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
46776167 |
aacaattatccacattgctcttaaattgatggtgatgcc |
46776205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University